「Primer」の共起表現(1語右で並び替え)

「Primer」の共起表現一覧(1語右で並び替え)

Primer

1 2 次へ＞

1語右で並び替え

該当件数:221件

Un Primer Amor In English A First Love was released as a
"Mi Primer Amor" - 6:12
"Un Primer Amor" was original sung by Monna Bell.
The composer for "Un Primer Amor" is unknown.
"Un Primer Amor" was the final released single from the a
Monna Bell originally sung "Un Primer Amor" in both French and English as a promotio
2000: Primer amor... a mil por hora as Marina Iturriaga Cam
Support multiple PCR primer analysis
He is the author of "Union Primer and Reading Book" (1882); "Jewish History Ethi
st Like You, Only Prettier, The Southern Belle Primer, and The Southern Belle Handbook are plentiful
Hilsey also prepared a juvenile version of his primer, and wrote De veri Corporis Esu in Sacramento
Normally primer and buffer optimisation is tested and achieved
ssDNA template is hybridized to a sequencing primer and incubated with the enzymes DNA polymerase,
re is suddenly reduced to 55 degree C at which primer and Taq-plymerase is added, but here the diffe
Rust-Oleum Primer and Spray Paint
the DNA template, non-specific binding between primer and template, and incomplete primer binding, l
s a fragmentation grenade with a P-42 friction primer and a 4.5 second delay time.
merase starts replication at the 3'-end of the primer, and copies the opposite strand.
enome, specific removal of the (-)-strand tRNA primer, and removal of the (+)-strand PPT primer.
tor of the Berdan rifle, the Berdan centerfire primer and numerous other weapons and accessories.
t, only very specific base pairing between the primer and the template will occur.
stem-loop structures, and functions as both a primer and a template for the creation of more msDNA.
Earth?, and the non-fiction works An American Primer and Chicago, Crossroads of American Enterprise
unintuitive, device appears in Chao's Mandarin Primer and all W. Simon's texts (including his Chines
e chain reaction determines the specificity of primer annealing.
helicase where it then synthesizes a short RNA primer approximately 11 ±1 nucleotides long, to which
It was preceded by the hornbook and the primer as early reading texts and by a variety of psa
lumn would be in the immediate vicinity of the primer as it detonated.
The website Metacritic rated Primer at 68 out of 100, while the similar site Rotte
Daniel Jack Gillespie, A Quantum Mechanics Primer, Aylesbury, Eng., International Textbook Co.,
Primer Banco del Istmo trading as Banistmo or Banco D
anking group that owned Panama's leading bank, Primer Banco del Istmo, and 106 other branches in Cos
It was the holding company of Primer Banco del Istmo, S.A. or Banistmo, the largest
Primer bestiariu (1990)
roducts due to the amplification of unexpected primer binding sites.
The primer binding site is on one of the two complementar
Nonspecific primer binding obscures polymerase chain reaction res
A primer binding site is a region of a nucleotide seque
A PCR primer binding site is a site where a polymerase chai
The selection of alternative and similar primer binding sites gives a selection of products, o
In addition to highly conserved primer binding sites, 16S rRNA gene sequences contain
The HIV primer binding site is a structured RNA element in th
Primer Black
Primer Black - Blood On The Headlights (2005)
Primer Bldg., Palanginan, Iba, Zambales in the Philip
specific chemistry, as in the case of aluminum primer, but more often, this is achieved through cont
attheworld.net, which is fairly extensive as a primer but has not been updated in several years.
d is still used today as a reference guide and primer by technical analysts and traders.
tle and William Smith in 1801, and The Musical Primer by Andrew Law in 1803, intended for use in sin
AAFTA Field Target Primer by Joe McDaniel
the synthesis of a short RNA segment (called a primer) complementary to a ssDNA template.
1991 the band performed a song in the Israeli primer contest of the Eurovision Song Contest.
Internet Technologies Primer, CulTech Publishing, [co-author Dr. Peter Roos
imers, and therefore, needs primase to add the primer de novo.
as gene prediction, sequence manipulation, PCR primer design etc.
If primer design is constraint by other factors and if p
simple and graphics-enhanced sequence view for primer design.
A primer designed for metal is still highly recommended
used as an initiating explosive in propellant primer devices and is a substitute for lead styphnate
Primer dimer formation often competes with formation
little contamination from unwanted products of primer dimers, hairpins, and alternative primer targe
Runner Up Primer Division Liga Indonesia 2005 with Persija
Runner Up in Primer Division Liga Indonesia 2006
By simplifying Calvinist theology the Primer enabled the Puritan child to define the limits
Primer esbozo de la letra A.
called the lagging strand, the primase makes a primer every few kilobases.
ional screening and experimentally verified by primer extension analysis This snoRNA is not related
Figure 2. MPEA - Microfluidic Primer Extension Assay
Primer extension is a technique whereby the 5' ends o
After biotin labelling, primer extension and washing, the Geniom Analyzer und
MS-SnuPE employs the primer extension method initially designed for analyz
Primer extension can be used to determine the start s
e experimentally verified by Northern blot and primer extension analysis.
ed that ldrD and rdlD are both transcribed and primer extension analysis showed the rdlD transcript
e experimentally verified by Northern blot and primer extension analysis .
le capture probes and the on-chip Microfluidic Primer Extension Assay (MPEA) enables direct microRNA
Selective 2′-hydroxyl acylation analyzed by primer extension, or SHAPE, takes advantage of reagen
within the P. falciparum strain 3DF genome by primer extension.
ago A. A. football team not only took over the primer football role of the University Club team.
ociates with DnaG (a primase) to form the only primer for the leading strand and to add RNA primers
h S. Gregory Boyd of the book Business & Legal Primer for Game Development, published by Charles Riv
The book is a primer for basic Buddhist philosophy with an analysis
thor of Understanding Multivariate Research: A Primer for Beginning Social Scientists (with Mitch Sa
free 3' hydroxyl end is released to serve as a primer for DNA synthesis by DNA polymerase III.
le in a New Age of War Portents of the Real: A Primer for Post-9/11.." Historical Materialism 16, no
w Course is widely recognized as the essential primer for physicians and other health care professio
Primer for America (1943)
Reapportionment: A Primer for Pennsylvanians.
Business & Legal Primer for Game Development.
Constitutional Courts: A Primer for Decision Makers
So you want to be a social worker: A primer for the Christian student
"A Primer for the Punctuation of Heart Disease" (The New
Singing Learned from Speech: A Primer for Teachers and Students: Macmillan, 1945.
The end of the sequenced strand is used as a primer for the next part of the long DNA sequence.
-author, with Brian Green, of Business & Legal Primer for Game Development (2007).
Her primer for the lay-reader, Coming to Life: How Genes
l 1855 was the elimination of the Maynard tape primer for the Model 1861 (the Maynard primer, a self
ween 1966 & 1969, this compilation serves as a primer for both the early years of Jefferson Airplane
1985 reprint had a conspicuous cover label, "A Primer for Adults Only".
Darwin Matters, he has assembled an invaluable primer for anyone caught up in an argument with a wel
Mr Mandaville's primer, Global Political Islam, is a well-informed ac
lipino historians consider the "first cry" (el primer grito).
Like Primer, he combines an enquiring eye for a song with
Advanced primer ignition (API) is used to make sure that the p
im weapon working on the principle of advanced primer ignition blowback.
h in 1819, the press published a Tamil grammar primer Ilakkana surukkam, a Tamil translation of Utta
According to an interview by Primer Impacto news, who were on the set of the remix
The video premiered on Univision's Primer Impacto on June 27, 2007.
From 1995 to 2010, he appeared on Primer Impacto, which airs on the Univision network.
She hosts Primer Impacto, a Spanish language news program which
Miami, Florida based television news program, Primer Impacto.
New England Primer: Improved for the More Easy Attaining the True
ord University, discovering the role of an RNA primer in the replication of DNA.
He was co-editor for A Primer in Lunar Geology, Multi-Ring Basins, and Geolo
K Street holds its course, it could serve as a primer in understanding modern-day politics".
It is also an extremely readable primer in the history and science of chemistry.
Gene Genealogies, Variation and Evolution - A Primer in Coalescent Theory.
If the primer initially (during the higher-temperature phase
onson, wife of Bronson, translated Worcester's Primer into Nocte (1840).
For this purpose, primer is designed to adhere to surfaces and to form
A poly-T oligonucleotide primer is hybridized onto the poly-A tail of the matu
The primer is allowed to extend one base pair into the C
In bacteria, the primer is synthesized during replication.
The English term primer is usually now reserved for those books writte
In order to initiate synthesis of DNA, a primer is needed.
From a known sequence a primer is designed to sequence across the circularise
of P76 are: Y position is 20340415....forward primer is gaagcaatactctgaaaagt.....reverse primer is
Primer is a paint product that allows finishing paint
A primer is a strand of nucleic acid that serves as a s
The primer is allowed to anneal to the RNA and reverse tr
This primer is used to jump 100 kb-300 kb intervals: a seq
RNA primer labeled at top.
tball team.he is the topgoalscorer of bahraini primer league in1998 (16) & 2003(18)
Tracking and saving primers to primer library
to the point of questioning the newly elected Primer Minister of Australia, Julia Gillard's lack of
iplinary research journal Nature Methods (MOTY primer, MOTY editorial, MOTY commentary).
Yo te escoji porque tu eres la primer mujer que fue Presidenta en Panama.
We Trade (1878); Our Merchant Marine (1882); A Primer of Tariff Reform (1884); Practical Economics (
tergate period; How to Win Arguments (1981), a primer of debating techniques; The Rise of the Right
A Primer of Infinitesimal Analysis.
A Primer Of Yoga Theory
Primer of the Mundari Language, 1896
A Primer of Public Administration, 1950 (ISBN 0-8371-94
four books, including The Cigarette Papers and Primer of Biostatistics.
“A Primer of Oriental Thought” Unique, Published by (OEO
He composed prolifically, and an organ primer of his enjoyed wide popularity.
It is advertised as "a child's primer of alphabet, counting & acting out songs".
It superseded Wright's earlier A Primer of the Gothic Language, and has been reprinted
The Kartilya ng Katipunan (English: Primer of the Katipunan) served as the guidebook for
a 2006 duPont-Columbia silver baton, offered a primer on stem cell research, as the interests of sci
n logic and mathematical philosophy, writing a primer on the subject with her husband which became a
advocated healthy eating and provided a basic primer on the four food groups: Meat, Dairy, Cereal,
vidjian is the author of The Kingdom of God: A Primer on the Christian Life (Banner of Truth), Do I
he process of electronic workflow and offers a primer on the use of XML markup, and a revised glossa
nd Retailers Guide to the Internet," a 32-page primer on how to build effective music-related websit
hael Ruse described it as “a simply invaluable primer on the subject that should be made compulsory
ntually a book, which has been described as "a primer on Internet marketing" ).
vity and magnetic data (refer to Dick Gibson's Primer on Gravity and Magnetics4).
Primer on Aging by Richard M. Brett (1988)
Frank Lloyd Wright: A Primer on Architectural Principles.
Kurrent script from a 1903-1914 primer on German, the 26 letters, ligatures, start of
Kurrent script from a 1903-1914 primer on German, the rest of the sample text
He writes a primer on policy called "Wonkbook," which is delivere
Primer on Cerebrovascular Diseases, by M.A. Welch, Lo
He followed it up with a primer on identifying DUIs before they become tragica
whitepaper entitled "Empowering Imagination: A Primer on the Ethical Imperative in Children's Market
phs: A Complete Introductory Guide is a modern primer on Egyptian language hieroglyphs, from the lat
ranklin Watts, 1972; Paperback Library, 1972), primer on feminism, including history, law, work, edu
irst volume of Menkui! as being "a pretty good primer on what this whole shonen-ai thing is all abou
ts, and Licit and Illicit Drugs is more than a primer on addiction.
its used the same sort of materials, such as a primer or hornbook that were used throughout the Nort
It can be used as a finish, or as a primer or sealer on bare wood before applying paint o
metals, such as untreated aluminium, require a primer; others may not.
ction, each fragment needs a unique amplifying primer pair.
nd detection of multiple targets with a single primer pair.
e amplified and quantified using just a single primer pair.
er tube, and a copper base that incorporated a primer pellet.
eleaser pheromones with short term effects and primer pheromones with long term effects.
ly identical repeats, and finishing tasks like primer picking and gap closure.
anced tools for finishing tasks like automated primer picking
te vitriol"), the phosphate Zn3(PO4)2 (used as primer pigment), the molybdate ZnMoO4 (used as white
Primer Plano I.Sat.
ired (actually it flashed in the pan, i.e. the primer powder failed to ignite the charge in the musk
After the launch of Primer Premier the company released SimVector, a plas
The company's first product, Primer Premier, was authored over 12 years ago, for d
He served as Prime Minister ( Primer presidente del Consejo de Ministros) for six y
ers of Kelly's newly formed band included John Primer, providing assistance on the guitar; David Hon
Primer received broadly positive reviews in the mains
freading) and 5'->3' exonuclease activity (RNA primer removal).
DNA polymerase I removes the primer, replacing it with DNA, and DNA ligase joins t
High-throughput primer search
bilities for multiplex PCR and high-throughput primer search and analysis.
7378.....Y position is 21151128....The forward primer sequence is ttatcctgagccgttgtccctg and the rev
NA-DNA hydrogen bonds are only formed when the primer sequence very closely matches the template seq
itor of the Oxford University Press' chemistry primer series, which has over a hundred titles to dat
The melting point of the primer sets the upper limit on annealing temperature.
d jazz scene, according to the book The Techno Primer setting "the tone for this movement", but also
he presence of a mismatch between template and primer, so successful amplification with an SNP-speci
ied is the one between the regions of greatest primer specificity; it is most likely that this is th

1 2 次へ＞