「PRIMER」の共起表現一覧(1語右で並び替え)
該当件数 : 221件
Un | Primer Amor In English A First Love was released as a |
"Mi | Primer Amor" - 6:12 |
"Un | Primer Amor" was original sung by Monna Bell. |
The composer for "Un | Primer Amor" is unknown. |
"Un | Primer Amor" was the final released single from the a |
Monna Bell originally sung "Un | Primer Amor" in both French and English as a promotio |
2000: | Primer amor... a mil por hora as Marina Iturriaga Cam |
Support multiple PCR | primer analysis |
He is the author of "Union | Primer and Reading Book" (1882); "Jewish History Ethi |
st Like You, Only Prettier, The Southern Belle | Primer, and The Southern Belle Handbook are plentiful |
Hilsey also prepared a juvenile version of his | primer, and wrote De veri Corporis Esu in Sacramento |
Normally | primer and buffer optimisation is tested and achieved |
ssDNA template is hybridized to a sequencing | primer and incubated with the enzymes DNA polymerase, |
re is suddenly reduced to 55 degree C at which | primer and Taq-plymerase is added, but here the diffe |
Rust-Oleum | Primer and Spray Paint |
the DNA template, non-specific binding between | primer and template, and incomplete primer binding, l |
s a fragmentation grenade with a P-42 friction | primer and a 4.5 second delay time. |
merase starts replication at the 3'-end of the | primer, and copies the opposite strand. |
enome, specific removal of the (-)-strand tRNA | primer, and removal of the (+)-strand PPT primer. |
tor of the Berdan rifle, the Berdan centerfire | primer and numerous other weapons and accessories. |
t, only very specific base pairing between the | primer and the template will occur. |
stem-loop structures, and functions as both a | primer and a template for the creation of more msDNA. |
Earth?, and the non-fiction works An American | Primer and Chicago, Crossroads of American Enterprise |
unintuitive, device appears in Chao's Mandarin | Primer and all W. Simon's texts (including his Chines |
e chain reaction determines the specificity of | primer annealing. |
helicase where it then synthesizes a short RNA | primer approximately 11 ±1 nucleotides long, to which |
It was preceded by the hornbook and the | primer as early reading texts and by a variety of psa |
lumn would be in the immediate vicinity of the | primer as it detonated. |
The website Metacritic rated | Primer at 68 out of 100, while the similar site Rotte |
Daniel Jack Gillespie, A Quantum Mechanics | Primer, Aylesbury, Eng., International Textbook Co., |
Primer Banco del Istmo trading as Banistmo or Banco D | |
anking group that owned Panama's leading bank, | Primer Banco del Istmo, and 106 other branches in Cos |
It was the holding company of | Primer Banco del Istmo, S.A. or Banistmo, the largest |
Primer bestiariu (1990) | |
roducts due to the amplification of unexpected | primer binding sites. |
The | primer binding site is on one of the two complementar |
Nonspecific | primer binding obscures polymerase chain reaction res |
A | primer binding site is a region of a nucleotide seque |
A PCR | primer binding site is a site where a polymerase chai |
The selection of alternative and similar | primer binding sites gives a selection of products, o |
In addition to highly conserved | primer binding sites, 16S rRNA gene sequences contain |
The HIV | primer binding site is a structured RNA element in th |
Primer Black | |
Primer Black - Blood On The Headlights (2005) | |
Primer Bldg., Palanginan, Iba, Zambales in the Philip | |
specific chemistry, as in the case of aluminum | primer, but more often, this is achieved through cont |
attheworld.net, which is fairly extensive as a | primer but has not been updated in several years. |
d is still used today as a reference guide and | primer by technical analysts and traders. |
tle and William Smith in 1801, and The Musical | Primer by Andrew Law in 1803, intended for use in sin |
AAFTA Field Target | Primer by Joe McDaniel |
the synthesis of a short RNA segment (called a | primer) complementary to a ssDNA template. |
1991 the band performed a song in the Israeli | primer contest of the Eurovision Song Contest. |
Internet Technologies | Primer, CulTech Publishing, [co-author Dr. Peter Roos |
imers, and therefore, needs primase to add the | primer de novo. |
as gene prediction, sequence manipulation, PCR | primer design etc. |
If | primer design is constraint by other factors and if p |
simple and graphics-enhanced sequence view for | primer design. |
A | primer designed for metal is still highly recommended |
used as an initiating explosive in propellant | primer devices and is a substitute for lead styphnate |
Primer dimer formation often competes with formation | |
little contamination from unwanted products of | primer dimers, hairpins, and alternative primer targe |
Runner Up | Primer Division Liga Indonesia 2005 with Persija |
Runner Up in | Primer Division Liga Indonesia 2006 |
By simplifying Calvinist theology the | Primer enabled the Puritan child to define the limits |
Primer esbozo de la letra A. | |
called the lagging strand, the primase makes a | primer every few kilobases. |
ional screening and experimentally verified by | primer extension analysis This snoRNA is not related |
Figure 2. MPEA - Microfluidic | Primer Extension Assay |
Primer extension is a technique whereby the 5' ends o | |
After biotin labelling, | primer extension and washing, the Geniom Analyzer und |
MS-SnuPE employs the | primer extension method initially designed for analyz |
Primer extension can be used to determine the start s | |
e experimentally verified by Northern blot and | primer extension analysis. |
ed that ldrD and rdlD are both transcribed and | primer extension analysis showed the rdlD transcript |
e experimentally verified by Northern blot and | primer extension analysis . |
le capture probes and the on-chip Microfluidic | Primer Extension Assay (MPEA) enables direct microRNA |
Selective 2′-hydroxyl acylation analyzed by | primer extension, or SHAPE, takes advantage of reagen |
within the P. falciparum strain 3DF genome by | primer extension. |
ago A. A. football team not only took over the | primer football role of the University Club team. |
ociates with DnaG (a primase) to form the only | primer for the leading strand and to add RNA primers |
h S. Gregory Boyd of the book Business & Legal | Primer for Game Development, published by Charles Riv |
The book is a | primer for basic Buddhist philosophy with an analysis |
thor of Understanding Multivariate Research: A | Primer for Beginning Social Scientists (with Mitch Sa |
free 3' hydroxyl end is released to serve as a | primer for DNA synthesis by DNA polymerase III. |
le in a New Age of War Portents of the Real: A | Primer for Post-9/11.." Historical Materialism 16, no |
w Course is widely recognized as the essential | primer for physicians and other health care professio |
Primer for America (1943) | |
Reapportionment: A | Primer for Pennsylvanians. |
Business & Legal | Primer for Game Development. |
Constitutional Courts: A | Primer for Decision Makers |
So you want to be a social worker: A | primer for the Christian student |
"A | Primer for the Punctuation of Heart Disease" (The New |
Singing Learned from Speech: A | Primer for Teachers and Students: Macmillan, 1945. |
The end of the sequenced strand is used as a | primer for the next part of the long DNA sequence. |
-author, with Brian Green, of Business & Legal | Primer for Game Development (2007). |
Her | primer for the lay-reader, Coming to Life: How Genes |
l 1855 was the elimination of the Maynard tape | primer for the Model 1861 (the Maynard primer, a self |
ween 1966 & 1969, this compilation serves as a | primer for both the early years of Jefferson Airplane |
1985 reprint had a conspicuous cover label, "A | Primer for Adults Only". |
Darwin Matters, he has assembled an invaluable | primer for anyone caught up in an argument with a wel |
Mr Mandaville's | primer, Global Political Islam, is a well-informed ac |
lipino historians consider the "first cry" (el | primer grito). |
Like | Primer, he combines an enquiring eye for a song with |
Advanced | primer ignition (API) is used to make sure that the p |
im weapon working on the principle of advanced | primer ignition blowback. |
h in 1819, the press published a Tamil grammar | primer Ilakkana surukkam, a Tamil translation of Utta |
According to an interview by | Primer Impacto news, who were on the set of the remix |
The video premiered on Univision's | Primer Impacto on June 27, 2007. |
From 1995 to 2010, he appeared on | Primer Impacto, which airs on the Univision network. |
She hosts | Primer Impacto, a Spanish language news program which |
Miami, Florida based television news program, | Primer Impacto. |
New England | Primer: Improved for the More Easy Attaining the True |
ord University, discovering the role of an RNA | primer in the replication of DNA. |
He was co-editor for A | Primer in Lunar Geology, Multi-Ring Basins, and Geolo |
K Street holds its course, it could serve as a | primer in understanding modern-day politics". |
It is also an extremely readable | primer in the history and science of chemistry. |
Gene Genealogies, Variation and Evolution - A | Primer in Coalescent Theory. |
If the | primer initially (during the higher-temperature phase |
onson, wife of Bronson, translated Worcester's | Primer into Nocte (1840). |
For this purpose, | primer is designed to adhere to surfaces and to form |
A poly-T oligonucleotide | primer is hybridized onto the poly-A tail of the matu |
The | primer is allowed to extend one base pair into the C |
In bacteria, the | primer is synthesized during replication. |
The English term | primer is usually now reserved for those books writte |
In order to initiate synthesis of DNA, a | primer is needed. |
From a known sequence a | primer is designed to sequence across the circularise |
of P76 are: Y position is 20340415....forward | primer is gaagcaatactctgaaaagt.....reverse primer is |
Primer is a paint product that allows finishing paint | |
A | primer is a strand of nucleic acid that serves as a s |
The | primer is allowed to anneal to the RNA and reverse tr |
This | primer is used to jump 100 kb-300 kb intervals: a seq |
RNA | primer labeled at top. |
tball team.he is the topgoalscorer of bahraini | primer league in1998 (16) & 2003(18) |
Tracking and saving primers to | primer library |
to the point of questioning the newly elected | Primer Minister of Australia, Julia Gillard's lack of |
iplinary research journal Nature Methods (MOTY | primer, MOTY editorial, MOTY commentary). |
Yo te escoji porque tu eres la | primer mujer que fue Presidenta en Panama. |
We Trade (1878); Our Merchant Marine (1882); A | Primer of Tariff Reform (1884); Practical Economics ( |
tergate period; How to Win Arguments (1981), a | primer of debating techniques; The Rise of the Right |
A | Primer of Infinitesimal Analysis. |
A | Primer Of Yoga Theory |
Primer of the Mundari Language, 1896 | |
A | Primer of Public Administration, 1950 (ISBN 0-8371-94 |
four books, including The Cigarette Papers and | Primer of Biostatistics. |
“A | Primer of Oriental Thought” Unique, Published by (OEO |
He composed prolifically, and an organ | primer of his enjoyed wide popularity. |
It is advertised as "a child's | primer of alphabet, counting & acting out songs". |
It superseded Wright's earlier A | Primer of the Gothic Language, and has been reprinted |
The Kartilya ng Katipunan (English: | Primer of the Katipunan) served as the guidebook for |
a 2006 duPont-Columbia silver baton, offered a | primer on stem cell research, as the interests of sci |
n logic and mathematical philosophy, writing a | primer on the subject with her husband which became a |
advocated healthy eating and provided a basic | primer on the four food groups: Meat, Dairy, Cereal, |
vidjian is the author of The Kingdom of God: A | Primer on the Christian Life (Banner of Truth), Do I |
he process of electronic workflow and offers a | primer on the use of XML markup, and a revised glossa |
nd Retailers Guide to the Internet," a 32-page | primer on how to build effective music-related websit |
hael Ruse described it as “a simply invaluable | primer on the subject that should be made compulsory |
ntually a book, which has been described as "a | primer on Internet marketing" ). |
vity and magnetic data (refer to Dick Gibson's | Primer on Gravity and Magnetics4). |
Primer on Aging by Richard M. Brett (1988) | |
Frank Lloyd Wright: A | Primer on Architectural Principles. |
Kurrent script from a 1903-1914 | primer on German, the 26 letters, ligatures, start of |
Kurrent script from a 1903-1914 | primer on German, the rest of the sample text |
He writes a | primer on policy called "Wonkbook," which is delivere |
Primer on Cerebrovascular Diseases, by M.A. Welch, Lo | |
He followed it up with a | primer on identifying DUIs before they become tragica |
whitepaper entitled "Empowering Imagination: A | Primer on the Ethical Imperative in Children's Market |
phs: A Complete Introductory Guide is a modern | primer on Egyptian language hieroglyphs, from the lat |
ranklin Watts, 1972; Paperback Library, 1972), | primer on feminism, including history, law, work, edu |
irst volume of Menkui! as being "a pretty good | primer on what this whole shonen-ai thing is all abou |
ts, and Licit and Illicit Drugs is more than a | primer on addiction. |
its used the same sort of materials, such as a | primer or hornbook that were used throughout the Nort |
It can be used as a finish, or as a | primer or sealer on bare wood before applying paint o |
metals, such as untreated aluminium, require a | primer; others may not. |
ction, each fragment needs a unique amplifying | primer pair. |
nd detection of multiple targets with a single | primer pair. |
e amplified and quantified using just a single | primer pair. |
er tube, and a copper base that incorporated a | primer pellet. |
eleaser pheromones with short term effects and | primer pheromones with long term effects. |
ly identical repeats, and finishing tasks like | primer picking and gap closure. |
anced tools for finishing tasks like automated | primer picking |
te vitriol"), the phosphate Zn3(PO4)2 (used as | primer pigment), the molybdate ZnMoO4 (used as white |
Primer Plano I.Sat. | |
ired (actually it flashed in the pan, i.e. the | primer powder failed to ignite the charge in the musk |
After the launch of | Primer Premier the company released SimVector, a plas |
The company's first product, | Primer Premier, was authored over 12 years ago, for d |
He served as Prime Minister ( | Primer presidente del Consejo de Ministros) for six y |
ers of Kelly's newly formed band included John | Primer, providing assistance on the guitar; David Hon |
Primer received broadly positive reviews in the mains | |
freading) and 5'->3' exonuclease activity (RNA | primer removal). |
DNA polymerase I removes the | primer, replacing it with DNA, and DNA ligase joins t |
High-throughput | primer search |
bilities for multiplex PCR and high-throughput | primer search and analysis. |
7378.....Y position is 21151128....The forward | primer sequence is ttatcctgagccgttgtccctg and the rev |
NA-DNA hydrogen bonds are only formed when the | primer sequence very closely matches the template seq |
itor of the Oxford University Press' chemistry | primer series, which has over a hundred titles to dat |
The melting point of the | primer sets the upper limit on annealing temperature. |
d jazz scene, according to the book The Techno | Primer setting "the tone for this movement", but also |
he presence of a mismatch between template and | primer, so successful amplification with an SNP-speci |
ied is the one between the regions of greatest | primer specificity; it is most likely that this is th |
こんにちは ゲスト さん
![]() ログイン |
Weblio会員(無料)になると
![]() |
こんにちは ゲスト さん
![]() ログイン |
Weblio会員(無料)になると
![]() |